2. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

chronic HBV infection

" in MedChemExpress (MCE) Product Catalog:

9

Inhibitors & Agonists

1

Natural
Products

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B0277A
    Vidarabine phosphate

    ara-AMP; ara-A 5'-monophosphate

    		 HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .
    Vidarabine phosphate
  • HY-145713
    HBV-IN-19

    		HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19
  • HY-145713A
    HBV-IN-19 TFA

    		HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19 TFA
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-N8168
    LPRP-Et-97543

    		HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-163124
    HBV-IN-43

    		HBV Infection
    HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .
    HBV-IN-43
  • HY-151134
    HBV-IN-25

    		HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .
    HBV-IN-25
  • HY-W352344
    2'-Deoxy-L-adenosine

    		HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
    2'-Deoxy-L-adenosine

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: